Sequence ID | >C171064264 |
Genome ID | CP017603 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium formicaceticum ATCC 27076 [CP017603] |
Start position on genome | 2611488 |
End posion on genome | 2611563 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
acgccataaa |
tRNA gene sequence |
GATCCATTAGCTCAGTCGGTAGAGCACCTGACTTTTAATCAGGGTGTCCCGCGTTCGAGT |
Downstream region at tRNA end position |
aatggagagg |
Secondary structure (Cloverleaf model) | >C171064264 Lys TTT a ACCA aatggagagg G - C A - T T - A C - G C - G A - T T - A T G T G G C G C A T G A A | | | | | G C C T C G C C G C G C G | | | | T T G G A G C T A A GTGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |