Sequence ID | >C171066501 |
Genome ID | CP017718 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Hyphomonas sp. Mor2 [CP017718] |
Start position on genome | 2304095 |
End posion on genome | 2304019 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
cctataattg |
tRNA gene sequence |
GGGCCGGTAGCTCAGGCGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGAGGTTCAAG |
Downstream region at tRNA end position |
cccttttcgg |
Secondary structure (Cloverleaf model) | >C171066501 Ile GAT g ACCA cccttttcgg G - C G - C G - C C - G C - G G - C G + T T G T C C T C C A G G A A | | | | | A C C T C G G G A G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |