Sequence ID | >WENV011660 |
Genome ID | AACY020317078 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 591 |
End posion on genome | 669 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aatcagatcT |
tRNA gene sequence |
GGGACCGTAGTTCAACCGGTTAGAGCACCGCCCTGTCACGGCGGAAGTTGCGGGTTCGAA |
Downstream region at tRNA end position |
Tcaccaccaa |
Secondary structure (Cloverleaf model) | >WENV011660 Asp GTC T GTTC Tcaccaccaa G - C G - C G - C A - T C - G C - G G - C T A T T G C C C A C A A A + | | | | G C C T T G G C G G G C G | | + | T T G G A G C T T A A AAGTT C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |