Sequence ID | >C171071819 |
Genome ID | CP018031 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Alteromonas sp. RW2A1 [CP018031] |
Start position on genome | 2853418 |
End posion on genome | 2853342 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
catttacagt |
tRNA gene sequence |
CGGTGAGTGGCGCAGCTTGGTAGCGCACTTGTTTTGGGTACAAGGGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
ctgctttttc |
Secondary structure (Cloverleaf model) | >C171071819 Pro TGG t ACCA ctgctttttc C - G G - C G - C T - A G - C A - T G - C T A T T G T C C A C G A G + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C T - A T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |