Sequence ID | >C171085201 |
Genome ID | CP018839 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Thauera chlorobenzoica 3CB1 [CP018839] |
Start position on genome | 462561 |
End posion on genome | 462486 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gcaaggcacc |
tRNA gene sequence |
GGGGGTATAGCTCAGTTGGTAGAGCAGTTGACTCTTAATCAATTGGTCCTAGGTTCGAGT |
Downstream region at tRNA end position |
acgaattcaa |
Secondary structure (Cloverleaf model) | >C171085201 Lys CTT c ACCA acgaattcaa G - C G - C G - C G - C G - C T + G A - T T G T G A T C C A T G A A | | | | | G T C T C G C T A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |