Sequence ID | >C171091725 |
Genome ID | CP019240 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Rhodoferax antarcticus DSM 24876 [CP019240] |
Start position on genome | 1893502 |
End posion on genome | 1893577 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
agcaagacta |
tRNA gene sequence |
GGGATGTTAGCTCAGTTGGTAGAGCAGCGGACTTTTAATCCGTTTGTCGTGGGTTCGACC |
Downstream region at tRNA end position |
gataaacctt |
Secondary structure (Cloverleaf model) | >C171091725 Lys TTT a ACCA gataaacctt G - C G - C G - C A - T T - A G - C T - A C C T C G C C C A T G A A | + | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A TTGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |