Sequence ID | >C171092167 |
Genome ID | CP019322 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Methylorubrum extorquens PSBB040 [CP019322] |
Start position on genome | 2665511 |
End posion on genome | 2665435 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cgcgcgccgt |
tRNA gene sequence |
AGGAGTGTAGCTCAACTGGTCAGAGCACCGGTCTCCAAAACCGGGGGTTGGGGGTTCGAG |
Downstream region at tRNA end position |
cggcgcccac |
Secondary structure (Cloverleaf model) | >C171092167 Trp CCA t GCCA cggcgcccac A - T G - C G - C A - T G - C T - A G - C T G T C T C C C A C A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T C A A GGGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |