Sequence ID | >C171092616 |
Genome ID | CP019389 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Seonamhaeicola sp. S2-3 [CP019389] |
Start position on genome | 1745778 |
End posion on genome | 1745866 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aatattataa |
tRNA gene sequence |
AGAGAGGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTATACCTCAAAAGGGT |
Downstream region at tRNA end position |
ttatttttat |
Secondary structure (Cloverleaf model) | >C171092616 Ser GGA a GCtg ttatttttat A - T G - C A - T G - C A - T G - C G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TATACCTCAAAAGGGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |