Sequence ID | >C171092634 |
Genome ID | CP019389 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Seonamhaeicola sp. S2-3 [CP019389] |
Start position on genome | 1385629 |
End posion on genome | 1385553 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ttttaaaaaa |
tRNA gene sequence |
GGGGCATTAGCTCAGTTGGCTAGAGCGTTTGGCTGGCAGCCAAAAGGTCATCGGTTCGAC |
Downstream region at tRNA end position |
aaagaggctt |
Secondary structure (Cloverleaf model) | >C171092634 Ala GGC a ACAA aaagaggctt G - C G - C G + T G - C C - G A - T T - A T C T T A G C C A T G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C T A G AGGTC T - A T - A T - A G - C G - C C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |