| Sequence ID | >C171098433 |
| Genome ID | CP019702 |
| Phylum/Class | Alphaproteobacteria |
| Species | Rhizobium rhizogenes K599 [CP019701, CP019702] |
|
Start position on genome
|
795641
|
|
End posion on genome
|
795716
|
|
Amino Acid
|
Ala
|
|
Anticodon
|
TGC
|
|
Upstream region at tRNA start position
|
cgagctggat
|
|
tRNA gene sequence
|
GGGGCTGTAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGTCAGCGGTTCGATC CCGCTCAGCTCCACCA
|
|
Downstream region at tRNA end position
|
tttgttttgt
|
| Secondary structure (Cloverleaf model) | >C171098433 Ala TGC
t ACCA tttgttttgt
G - C
G - C
G + T
G - C
C - G
T - A
G - C C T
T T C G C C A
C G A A | | | | | G
T C T C G A G C G G C
G | | | | T T
G G A G C
G A A GGGTC
C - G
C - G
T - A
G - C
C - G
T A
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |