| Sequence ID | >C171100352 |
| Genome ID | CP019865 |
| Phylum/Class | Chloroflexota |
| Species | Dehalococcoides mccartyi KBTCE2 [CP019865] |
| Start position on genome | 1213065 |
| End posion on genome | 1213141 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
tttacgattt |
| tRNA gene sequence |
AGGAGTGTAGCTCAGTCCGGTAGAGCAGCGGTCTCCAAAACCGCCGGTCGAGGGTTCGAA |
| Downstream region at tRNA end position |
tattggccga |
| Secondary structure (Cloverleaf model) | >C171100352 Trp CCA
t GCCA tattggccga
A - T
G - C
G - C
A - T
G - C
T - A
G - C T A
T C T T C C A
T G A A | | + | | G
C C T C G G A G G G C
C | | | | T T
G G A G C
G T A A CGGTC
G - C
C - G
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |