Sequence ID | >C171100400 |
Genome ID | CP019866 |
Search identical group | |
Phylum/Class | Chloroflexota |
Species | Dehalococcoides mccartyi KBTCE3 [CP019866] |
Start position on genome | 1155766 |
End posion on genome | 1155840 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tctttggctg |
tRNA gene sequence |
GGCGACGTAGCCAAGTGGCAAGGCAGGGGTCTGCAAAACCCCTATTCAGCGGTTCGAATC |
Downstream region at tRNA end position |
gatactttca |
Secondary structure (Cloverleaf model) | >C171100400 Cys GCA g TCCA gatactttca G - C G - C C - G G - C A - T C - G G - C T A T T C G C C A G A A | | | | | G T A C C G A G C G G C G | | | T T G A G G C C A A TATTC G - C G - C G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |