Sequence ID | >C171100449 |
Genome ID | CP019867 |
Search identical group | |
Phylum/Class | Chloroflexota |
Species | Dehalococcoides mccartyi KBDCA1 [CP019867] |
Start position on genome | 1305496 |
End posion on genome | 1305572 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tatttctttc |
tRNA gene sequence |
GGGCGGTTAGCTCAGCTGGTTAGAGCACCTGCTTTACACGCAGGGGGTCATAGGTTCGAA |
Downstream region at tRNA end position |
ttttttgaac |
Secondary structure (Cloverleaf model) | >C171100449 Val TAC c ACCA ttttttgaac G - C G - C G - C C - G G - C G - C T - A T A T T A T C C A C G A A | | | | | G T C T C G A T A G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G T - A G - C C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |