| Sequence ID | >C171100497 |
| Genome ID | CP019868 |
| Phylum/Class | Chloroflexota |
| Species | Dehalococcoides mccartyi KBDCA2 [CP019868] |
| Start position on genome | 1348194 |
| End posion on genome | 1348270 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
tttgttgcag |
| tRNA gene sequence |
GCCCCTGTAGCTCAGTAGGATAGAGCAGCGGTTTCCTAAACCGCGTGTCGGGCGTTCGAA |
| Downstream region at tRNA end position |
ctttctaaag |
| Secondary structure (Cloverleaf model) | >C171100497 Arg CCT
g ACCA ctttctaaag
G + T
C - G
C - G
C - G
C - G
T - A
G - C T A
T C C C G C A
T G A A | | | | | G
A C T C G G G G C G C
G | | | | T T
G G A G C
A T A A GTGTC
G - C
C - G
G - C
G - C
T - A
T A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |