Sequence ID | >C171100518 |
Genome ID | CP019868 |
Search identical group | |
Phylum/Class | Chloroflexota |
Species | Dehalococcoides mccartyi KBDCA2 [CP019868] |
Start position on genome | 277425 |
End posion on genome | 277350 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ggtgctccgt |
tRNA gene sequence |
GGGGCTGTAGCTTAGTCGGGAGAGCGCCTCCTTTGCAAGGAGGAGGTCAGGGGTTCGAAT |
Downstream region at tRNA end position |
aaggtatcaa |
Secondary structure (Cloverleaf model) | >C171100518 Ala TGC t ACCA aaggtatcaa G - C G - C G + T G - C C - G T - A G - C T A T T C C C C A T G A A | | | | | G C T T C G A G G G G C G + | | | T T G G A G C G A G AGGTC C - G C - G T - A C - G C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |