Sequence ID | >C171100915 |
Genome ID | CP019915 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Halomonas sp. 'Soap Lake #7' [CP019915] |
Start position on genome | 854027 |
End posion on genome | 854114 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gcaaaaatgt |
tRNA gene sequence |
GGAGAGGTGTCCGAGTGGTCGAAGGAGCACGCCTGGAAAGTGTGTAAGTCGAAAGGCTTC |
Downstream region at tRNA end position |
cagaatatag |
Secondary structure (Cloverleaf model) | >C171100915 Ser GGA t GCCA cagaatatag G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T T A G G A C G A G TAAGTCGAAAGGCTTC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |