Sequence ID | >C171107681 |
Genome ID | CP020442 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Paracoccus yeei FDAARGOS_252 [CP020442] |
Start position on genome | 2160884 |
End posion on genome | 2160811 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
aagccctgac |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCAGCAGCCTTCCAAGCTGAATACGTGGGTTCGATTCC |
Downstream region at tRNA end position |
tttcccttcc |
Secondary structure (Cloverleaf model) | >C171107681 Gly TCC c TCCA tttcccttcc G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A A A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A ATAC G A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |