Sequence ID | >C171110895 |
Genome ID | CP020616 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Coxiella burnetii RSA 439 [CP020616] |
Start position on genome | 611962 |
End posion on genome | 612037 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tagcaacacT |
tRNA gene sequence |
GCGCCCGTAGCTCACTCGGATAGAGCATCGGCCTTCTAAGCCGAGGGTAGCAGGTTCGAA |
Downstream region at tRNA end position |
tcagaggaca |
Secondary structure (Cloverleaf model) | >C171110895 Arg TCT T GAgt tcagaggaca G - C C - G G - C C - G C - G C - G G - C T A T C G T C C A T C A A | | | | | G C C T C G G C A G G C G | | | | T T G G A G C A T A A GGGTA T - A C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |