Sequence ID | >C171131144 |
Genome ID | LT799839 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium chauvoei JF4335 [LT799839] |
Start position on genome | 2732839 |
End posion on genome | 2732764 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
caccatattt |
tRNA gene sequence |
GGGGGTATAGCTCAGTTGGGAGAGCACTTGCCTTGCACGCAAGGGGTCAAGAGTTCGAAT |
Downstream region at tRNA end position |
aaaagttacg |
Secondary structure (Cloverleaf model) | >C171131144 Ala TGC t ACCA aaaagttacg G - C G - C G + T G - C G + T T - A A - T T A T T T C T C A T G A A | | | | | G T C T C G A A G A G C G | | | | T T G G A G C G A A GGGTC C - G T - A T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |