Sequence ID | >W131153055 |
Genome ID | AQMQ01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Brucella abortus NI593 [AQMQ] |
Start position on genome | 1487442 |
End posion on genome | 1487518 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agcgacgcgt |
tRNA gene sequence |
GGCGGAGTAGCTCAGTAGGTTAGAGCAGAGGAATCATAATCCTTGTGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
acgctcccac |
Secondary structure (Cloverleaf model) | >W131153055 Met CAT t ACCA acgctcccac G + T G - C C - G G - C G - C A - T G - C T A T C T C C C A T G A A | + | | | G A C T C G G G G G G C G | | | | T T G G A G C T T A A GTGTC G + T A - T G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |