Sequence ID | >W131172288 |
Genome ID | ARGU01000044 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Arthrobacter sp. 161MFSha2.1 [ARGU] |
Start position on genome | 95057 |
End posion on genome | 95141 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atgccggccg |
tRNA gene sequence |
GCGCGAGTGGTGAAATTGGCAGACACGCAGGATTTAGGTTCCTGTGCCTTCGGGCGTGGG |
Downstream region at tRNA end position |
gagtcaagaa |
Secondary structure (Cloverleaf model) | >W131172288 Leu TAG g ACAA gagtcaagaa G - C C - G G - C C - G G + T A - T G - C T G T C C C C C A T A A G | | | | | A T A G T G G G G G G C G | | | T T G A C A C C A G G TGCCTTCGGGCGT C - G A - T G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |