Sequence ID | >W131204529 |
Genome ID | ATCB01000001 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium breve HPH0326 [ATCB] |
Start position on genome | 829012 |
End posion on genome | 828937 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aaacaccatg |
tRNA gene sequence |
GTGGCCATAGCTCAGTTGGTAGAGCATCTGATTGTGGTTCAGAAGGTCGCGCGTTCGAGC |
Downstream region at tRNA end position |
gcaagaccct |
Secondary structure (Cloverleaf model) | >W131204529 His GTG g CCCA gcaagaccct G - C T - A G - C G - C C - G C - G A - T C G T T G C G C A T G A A + | | | | G T C T C G G C G C G C G | | | | T T G G A G C T A A AGGTC T - A C - G T - A G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |