Sequence ID | >W131174330 |
Genome ID | ARIK01000021 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Thioalkalivibrio sp. ALE27 [ARIK] |
Start position on genome | 181869 |
End posion on genome | 181944 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tgcgcccaat |
tRNA gene sequence |
TCCCCGGTAGCTCAGTCGGTAGAGCGGGTGACTGTTAATCACTAGGTCGGCGGTTCGAGC |
Downstream region at tRNA end position |
gacaaagaaa |
Secondary structure (Cloverleaf model) | >W131174330 Asn GTT t GCCA gacaaagaaa T - A C - G C - G C - G C - G G - C G - C C G T C T G C C A T G A A | + | | | G C C T C G G G C G G C G | | | | T T G G A G C T A G AGGTC G + T G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |