Sequence ID | >W131166926 |
Genome ID | ARCV01000005 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Methyloversatilis thermotolerans NVD [ARCV] |
Start position on genome | 420350 |
End posion on genome | 420274 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cccccttccc |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTACTGCCCTCCGAAGGCAGGGGTCGTGCGTTCGAA |
Downstream region at tRNA end position |
gtcatcagaa |
Secondary structure (Cloverleaf model) | >W131166926 Arg CCG c GCCA gtcatcagaa G - C C - G G - C C - G C - G C - G G - C T A T C G C G C A C G A A | + | | | G T C T C G G T G C G C G | | | + T T G G A G T A T A A GGGTC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |