Sequence ID | >W131089945 |
Genome ID | AOFD01000030 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Arthrobacter nitrophenolicus SJCon [AOFD] |
Start position on genome | 24801 |
End posion on genome | 24883 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgtattccgc |
tRNA gene sequence |
GCCCGAGTGGCGGAATTGGCAGACGCGCCGCACTCAAAATGCGGTATCGAAAGGTGTGTG |
Downstream region at tRNA end position |
catatcccct |
Secondary structure (Cloverleaf model) | >W131089945 Leu CAA c ACgg catatcccct G - C C - G C - G C - G G - C A - T G - C T G T C A C C C A T A A G | | | | | G T G G C G G T G G G C G | | | T T G A C G C C A G G TATCGAAAGGTGT C - G C - G G - C C - G A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |