Sequence ID | >W131162754 |
Genome ID | AQZE01000005 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Salinispora vitiensis DSM 45548 [AQZE] |
Start position on genome | 112055 |
End posion on genome | 112128 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gccgggacgt |
tRNA gene sequence |
GCGGACGTAGCGCAGCTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGGGTTCGAAT |
Downstream region at tRNA end position |
agatgccgcc |
Secondary structure (Cloverleaf model) | >W131162754 Gly GCC t TCgg agatgccgcc G - C C - G G - C G - C A - T C - G G - C T A T T G C C C A C G A A + | | | | G T C G C G G C G G G C G | | | | T T G G C G C T A A GGGTC T - A C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |