Sequence ID | >W131172946 |
Genome ID | ARHH01000078 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Salinispora arenicola CNY280 [ARHH] |
Start position on genome | 1590 |
End posion on genome | 1516 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ggatgagcta |
tRNA gene sequence |
GGTCCTGTGGAGCAGTTGGAGTGCTCGCCGCCCTGTCAAGGCGGAGGTCGCGGGTTCAAG |
Downstream region at tRNA end position |
ccggtgaagg |
Secondary structure (Cloverleaf model) | >W131172946 Asp GTC a GCag ccggtgaagg G - C G - C T - A C - G C - G T - A G - C T G T T G C C C A T G A G + | | | | A T C G A G G C G G G C G | | | | T T G G C T C A G T G AGGTC C - G C - G G - C C - G C - G C A T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |