Sequence ID | >W131221704 |
Genome ID | AUAR01000006 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfomicrobium escambiense DSM 10707 [AUAR] |
Start position on genome | 32490 |
End posion on genome | 32581 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tcccgaacgc |
tRNA gene sequence |
GGAGAGGTGGCCGAGTCTGGCTTAAGGCGCACGCCTGGAAAGTGTGTGTACCTTAACGGG |
Downstream region at tRNA end position |
tttttgacaa |
Secondary structure (Cloverleaf model) | >W131221704 Ser GGA c GCCA tttttgacaa G - C G - C A - T G - C A - T G - C G - C T A T T C T C C A C T G A G + | | | | G T G C C G G G A G G C G | | | T T G A G G C C T T A G TGTACCTTAACGGGTACC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |