Sequence ID | >W131204807 |
Genome ID | ATCG01000001 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Veillonella sp. HPA0037 [ATCG] |
Start position on genome | 242730 |
End posion on genome | 242805 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cgccattcat |
tRNA gene sequence |
GCCTCGGTAGCTCAGTCGGTAGAGCAACGGACTGAAAATCCGTGTGTCGACAGTTCGATT |
Downstream region at tRNA end position |
tgtacatgcg |
Secondary structure (Cloverleaf model) | >W131204807 Phe GAA t ACCA tgtacatgcg G - C C - G C - G T - A C - G G + T G - C T T T C T G T C A T G A A | | | | | G C C T C G G A C A G C G | | | | T T G G A G C T A A GTGTC A - T C - G G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |