Sequence ID | >W131164720 |
Genome ID | ARBA01000001 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Methylotenera mobilis 13 [ARBA] |
Start position on genome | 100983 |
End posion on genome | 100907 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tgccgacctt |
tRNA gene sequence |
CGGCGTGTAGCGTAGCCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
atttaattgg |
Secondary structure (Cloverleaf model) | >W131164720 Pro TGG t ACCA atttaattgg C - G G - C G - C C - G G - C T - A G - C T A T C T C T C A C G A A | + | | | G C T G C G G G G A G C T + | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |