Sequence ID | >W131207563 |
Genome ID | ATGT01000002 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Brucella abortus 90-0737 [ATGT] |
Start position on genome | 462863 |
End posion on genome | 462945 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cggttcagaa |
tRNA gene sequence |
GCGGATGTGGCGAAATTGGTAGACGCACCAGATTTAGGTTCTGGCGGGAGACCGTGGGGG |
Downstream region at tRNA end position |
acgccataag |
Secondary structure (Cloverleaf model) | >W131207563 Leu TAG a ACCA acgccataag G - C C - G G - C G - C A - T T - A G - C T G T C T C C C A T A A G | + | | | G T A G C G G G G G G C G | | | T T G A C G C T A G A CGGGAGACCGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |