Sequence ID | >W131224812 |
Genome ID | AUDB01000006 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Maridesulfovibrio hydrothermalis AM13 = DSM 14728 [AUDB] |
Start position on genome | 93249 |
End posion on genome | 93338 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tcacccaagc |
tRNA gene sequence |
GGAGAGGTGTCCGAGTCCGGCTTAAGGAGCACGCCTGGAAAGCGTGTATAGTTAACGCTA |
Downstream region at tRNA end position |
gtttggttat |
Secondary structure (Cloverleaf model) | >W131224812 Ser GGA c GCCA gtttggttat G - C G - C A - T G - C A - T G - C G - C T A T T C T C C A C T G A G + | | | | G C G C C T G G A G G C G | | | T T G A G G A C T T A G TATAGTTAACGCTATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |