Sequence ID | >W131052943 |
Genome ID | AMZQ01000002 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter showae CSUNSWCD [AMZQ] |
Start position on genome | 32454 |
End posion on genome | 32528 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
agagtttgac |
tRNA gene sequence |
GCTCATATGGCTCAGAGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCGCGGGTTCAAGTC |
Downstream region at tRNA end position |
cggattttag |
Secondary structure (Cloverleaf model) | >W131052943 Thr GGT c TCCA cggattttag G - C C - G T - A C - G A - T T - A A - T T G T C G C C C A G A G | | | | | A A C T C G G C G G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |