Sequence ID | >W131061490 |
Genome ID | ANIU01000396 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Rhodococcus wratislaviensis IFP 2016 [ANIU] |
Start position on genome | 8550 |
End posion on genome | 8637 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gctcctccac |
tRNA gene sequence |
GGAGGATTCGCCTAGTGGCCTATGGCGCTCGCCTGGAACGCGGGTTGGGTTAACGCCCTC |
Downstream region at tRNA end position |
caggaacccc |
Secondary structure (Cloverleaf model) | >W131061490 Ser GGA c GCCA caggaacccc G - C G - C A - T G - C G - C A - T T - A T A T T C C C C A T G A C | | | | | A G T C C G A G G G G C G | | | T T C T G G C C T A G TTGGGTTAACGCCCTC C - G T + G C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |