Sequence ID | >W131051996 |
Genome ID | AMYG01000059 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Thermoanaerobacter thermohydrosulfuricus WC1 [AMYG] |
Start position on genome | 13 |
End posion on genome | 87 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tttaagagat |
tRNA gene sequence |
GCGGATGTGGCTCAGCGGTAGAGCATCGGCTTCCCAAGCCGAGGATCGCGGGTTCGAATC |
Downstream region at tRNA end position |
taagaaaatg |
Secondary structure (Cloverleaf model) | >W131051996 Gly CCC t TCCA taagaaaatg G - C C - G G - C G - C A - T T - A G - C T A T T G C C C A G A G + | | | | G C C T C G G C G G G C G | | | | T T G G A G C T A A GGATC T - A C - G G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |