Sequence ID | >W131035863 |
Genome ID | AJSR01002742 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio harveyi HENC-02 [AJSR] |
Start position on genome | 14 |
End posion on genome | 89 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
taatttgagt |
tRNA gene sequence |
GCTGATATAGCTCAGGTGGTAGAGCGCATCCTTGGTAAGGATGAGGTCGGCAGTTCGAGT |
Downstream region at tRNA end position |
gctctcaaag |
Secondary structure (Cloverleaf model) | >W131035863 Thr GGT t ACCA gctctcaaag G - C C - G T - A G - C A - T T - A A - T T G T C C G T C A G G A A | | | | | G T C T C G G G C A G C G | | | | T T G G A G C T A G AGGTC C - G A - T T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |