Sequence ID | >W131251598 |
Genome ID | CAVO010000057 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Megasphaera massiliensis NP3 [CAVO] |
Start position on genome | 13547 |
End posion on genome | 13471 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tgcactgtat |
tRNA gene sequence |
GGGCGGTTAGCTCAGTTGGTTAGAGTATCTCGTTGACATCGAGGGGGTCGATGGTTCGAA |
Downstream region at tRNA end position |
tacatgaaaa |
Secondary structure (Cloverleaf model) | >W131251598 Val GAC t ACCA tacatgaaaa G - C G - C G - C C - G G - C G - C T - A T A T T T A C C A T G A A + | | | | G T C T C G G A T G G C G | | | + T T G G A G T T T A A GGGTC T + G C - G T - A C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |