Sequence ID | >W131188324 |
Genome ID | ASAN01000011 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Elizabethkingia meningoseptica ATCC 13253 = NBRC 12535 [ASAN] |
Start position on genome | 16056 |
End posion on genome | 16141 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aaaaaaaact |
tRNA gene sequence |
GGGGAGATACCAGAGCGGCCAAATGGGACGGACTGTAACTCCGTTGTCGTGAGACTTCGC |
Downstream region at tRNA end position |
tttttttaaa |
Secondary structure (Cloverleaf model) | >W131188324 Tyr GTA t ACAA tttttttaaa G - C G - C G - C G - C A - T G - C A - T T A T C G T C C A C G A A | | | | | G G G A C C G C A G G C G | | | T T C A T G G C A A G TGTCGTGAGACTTC A - T C - G G - C G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |