Sequence ID | >W131224580 |
Genome ID | AUCX01000014 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Maridesulfovibrio bastinii DSM 16055 [AUCX] |
Start position on genome | 129793 |
End posion on genome | 129868 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gcaacacgcg |
tRNA gene sequence |
GTGGGTGTAGCTCAGTTGGTAGAGCACCTGGTTGTGGCCCAGGTGGCCGAGGGTTCAAGT |
Downstream region at tRNA end position |
gatataaaaa |
Secondary structure (Cloverleaf model) | >W131224580 His GTG g CCCA gatataaaaa G - C T - A G - C G + T G - C T - A G - C T G T T T C C C A T G A A + | | | | A T C T C G G A G G G C G | | | | T T G G A G C T A A TGGCC C - G C - G T - A G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |