Sequence ID | >W131221305 |
Genome ID | AUAJ01000002 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xylella fastidiosa subsp. multiplex ATCC 35871 [AUAJ] |
Start position on genome | 99233 |
End posion on genome | 99308 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gtaagaaatt |
tRNA gene sequence |
GCCGCTTTAGCTCAGTTGGTAGAGCAACTGATTTGTAATCAGTAGGTCCACAGTTCGAAT |
Downstream region at tRNA end position |
tataaatcaa |
Secondary structure (Cloverleaf model) | >W131221305 Thr TGT t ACCA tataaatcaa G - C C - G C - G G - C C - G T - A T - A T A T G T G T C A T G A A | | | | | G T C T C G C A C A G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |