Sequence ID | >W131225928 |
Genome ID | AUDZ01000012 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Halomonas halocynthiae DSM 14573 [AUDZ] |
Start position on genome | 110274 |
End posion on genome | 110349 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
taaacacctt |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTTAATCAATTGGTCGTAGGTTCGAAT |
Downstream region at tRNA end position |
aataccgcgc |
Secondary structure (Cloverleaf model) | >W131225928 Lys TTT t ACCA aataccgcgc G - C G - C G - C T - A C - G G - C T - A T A T C A T C C A T G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |