Sequence ID | >C004047 |
Genome ID | CP000494 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Bradyrhizobium sp. BTAi1 [CP000494] |
Start position on genome | 4237965 |
End posion on genome | 4238041 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tccaggagat |
tRNA gene sequence |
CGGGGTATAGCGCAGCCTGGTAGCGCGGCAGTTTTGGGTACTGCAGGTCGTTGGTTCGAA |
Downstream region at tRNA end position |
tttcccaggc |
Secondary structure (Cloverleaf model) | >C004047 Pro TGG t ACCA tttcccaggc C - G G - C G - C G - C G - C T + G A - T T A T C G A C C A C G A A | + | | | G C C G C G G T T G G C T | | | | T T G G C G C G T A G AGGTC G - C C - G A - T G - C T - A T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |