Sequence ID | >C005964 |
Genome ID | CR931997 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium jeikeium K411 K411 [CR931997] |
Start position on genome | 970413 |
End posion on genome | 970337 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
agcacttatc |
tRNA gene sequence |
GCCCCAGTAGCCCAATTGGCAGAGGCAACGGATTCAAAACCCGTCCAGTGTGAGTTCGAG |
Downstream region at tRNA end position |
tttcaccccc |
Secondary structure (Cloverleaf model) | >C005964 Leu CAA c ACGA tttcaccccc G - C C - G C - G C - G C - G A - T G - C T G T C A C T C A T A A A | | | | | G T C C C G G T G A G C G | | | T T G A G G C C A G A CCAGT A - T C - G G - C G - C A C T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |