Sequence ID | >C006241 |
Genome ID | CP000382 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium novyi NT [CP000382] |
Start position on genome | 2533379 |
End posion on genome | 2533304 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tccaccattt |
tRNA gene sequence |
GGGGGTATAGCTCAGTTGGGAGAGCACCTGCCTTGCACGCAGGGGGTCAAGAGTTCGAAT |
Downstream region at tRNA end position |
aattaaaaga |
Secondary structure (Cloverleaf model) | >C006241 Ala TGC t ACCA aattaaaaga G - C G - C G + T G - C G + T T - A A - T T A T T T C T C A T G A A | | | | | G T C T C G A A G A G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |