Sequence ID | >WENV012913 |
Genome ID | AACY020353061 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 177 |
End posion on genome | 254 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tcatcgcctT |
tRNA gene sequence |
GCGCCGTTAGTTCAGTTGGTAGAACGCAGGTCTCCAAAACCTGTTGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
Gatgaacccc |
Secondary structure (Cloverleaf model) | >WENV012913 Trp CCA T GTCC Gatgaacccc G - C C - G G - C C - G C - G G - C T - A T G T C C T C C A T G A A | | + | | G T C T T G G G G G G C G | | | | T T G G A A C T A G TTGTC C - G A - T G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |