| Sequence ID | >C007593 |
| Genome ID | CP000688 |
| Phylum/Class | Chloroflexota |
| Species | Dehalococcoides mccartyi [CP000688] |
| Start position on genome | 760830 |
| End posion on genome | 760904 |
| Amino Acid | Gly |
| Anticodon | CCC |
| Upstream region at tRNA start position |
ctcaaaactt |
| tRNA gene sequence |
GCGGGTGTAACTCAGCGGTAGAGTGCTTGCTTCCCAAGTAAGACGTCGCGGGTTCGAATC |
| Downstream region at tRNA end position |
taacaaattt |
| Secondary structure (Cloverleaf model) | >C007593 Gly CCC
t TCCA taacaaattt
G - C
C - G
G - C
G - C
G - C
T - A
G - C T A
T T G C C C A
G A A + | | | | G
C C T C A G C G G G C
G | | | | T T
G G A G T
T A G ACGTC
C - G
T - A
T - A
G + T
C - G
T A
T A
C C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |