Sequence ID | >C007642 |
Genome ID | AJ965256 |
Search identical group | |
Phylum/Class | Chloroflexota |
Species | Dehalococcoides mccartyi CBDB1 [AJ965256] |
Start position on genome | 1006848 |
End posion on genome | 1006922 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agcatattga |
tRNA gene sequence |
CGCGGGGTGGAGCAGTGGTAGCTCGTCGGGCTCATAACCCGAAGGCCATAGGTTCGAATC |
Downstream region at tRNA end position |
attctaaagc |
Secondary structure (Cloverleaf model) | >C007642 Met CAT a ACCA attctaaagc C T G - C C - G G - C G - C G - C G - C T A T T A T C C A G A G | | | | | G T C G A G A T A G G C G | | | | T T G G C T C T A G AGGCC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |