Sequence ID | >C007891 |
Genome ID | CR522870 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfotalea psychrophila LSv54 [CR522870] |
Start position on genome | 3096676 |
End posion on genome | 3096602 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tttgatggtt |
tRNA gene sequence |
TGGGGCGTCGCCAAGCGGTAAGGCACCAGGTTTTGATCCTGGCATGCGTAGGTTCGAATC |
Downstream region at tRNA end position |
cttttgttac |
Secondary structure (Cloverleaf model) | >C007891 Gln TTG t GCCA cttttgttac T - A G - C G - C G - C G - C C - G G - C T A T C G T C C A G A C | + | | | G C A C C G G T A G G C G | | | T T G A G G C T A A CATGC C - G C - G A - T G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |