| Sequence ID | >WENV013234 |
| Genome ID | AACY020363654 |
| Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
| Species | |
| Start position on genome | 476 |
| End posion on genome | 567 |
| Amino Acid | Ser |
| Anticodon | TGA |
| Upstream region at tRNA start position |
ccttgcgaaC |
| tRNA gene sequence |
GGAGAGATGGCTGAGCGGTTGAAAGCACCGGTCTTGAAAACCGGCAAAGGGGCAACTCTT |
| Downstream region at tRNA end position |
Tttttcaata |
| Secondary structure (Cloverleaf model) | >WENV013234 Ser TGA
C GCCA Tttttcaata
G - C
G - C
A - T
G - C
A - T
G - C
A - T T A
T G A C C C A
C G A G | | | | | G
G G T C G C T G G G C
G | | | T T
T A A G C
T G A A CAAAGGGGCAACTCTTTC
C - G
C - G
G - C
G - C
T - A
C A
T A
T G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |