Sequence ID | >C015818 |
Genome ID | CP000082 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Psychrobacter arcticus 273-4 [CP000082] |
Start position on genome | 2517802 |
End posion on genome | 2517892 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gactaaaaac |
tRNA gene sequence |
GGTGAAGTGGGTGAGTGGCTGAAACCGCACGCCTGGAAAGTGTGTATACGTTAATAGCGT |
Downstream region at tRNA end position |
atcttagtta |
Secondary structure (Cloverleaf model) | >C015818 Ser GGA c ACCA atcttagtta G - C G - C T - A G - C A - T A - T G - C T A T C T C C C A T G A G | | | | | G G G T G G G A G G G C G | | | T T C A A C C T G A G TATACGTTAATAGCGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |